Suggested problems

Biological Motivation

Need to have a luxury experience on the excursion you are orchestrating? Taking everything into account, kindly oblige Delta Airlines, book your flight tickets with us, and get given sensational offers and significant limits. All you got the chance to do is hold your cell and dial us at Delta Airlines Reservation Number +1-833-908-0085 which is successfully opened on the web. Besides, you get involved in squeezing your stuff and pass on the rest to us. You worry about the outfits you need to convey, not with regards to how the excursion will fit in your monetary breaking point. Prepared with regards to paying high charges for your next air travel? We perceive how much strain it can make when you are endeavoring to keep up a monetary rebate for your movement expenses and you can't find a reasonable ticket cost wherever. Make an effort not to get anxious over it. Just call our assistance official at Delta Assist Customer Support Number and get the best markdown on the whole of your air tickets.

[Delta Airlines Office Johannesburg][1]

[1]: https://www.justcol.com/address/delta-airlines-office-johannesburg/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21