Feb. 17, 2022, 4:43 p.m. by AFOTIMBER
Biological Motivation
Buy Wholesale Lumber. Select from more than 50 species of exotic timber sustainably harvested from African forest and sawn with precise modern machinery, air dried or kiln dried, carefully graded into FAS or AIC quality and supplied in random measurements or cut exactly to customer specification and customization. Browse bellow to Buy Wholesale Lumber by placing a Quote to begin a long term purchase partnership. https://afotimber.com/
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
