Suggested problems

Our Sexy Escorts in Aerocity, Delhi| 8053152443

Feb. 15, 2022, 12:02 p.m. by niharikasingh

Biological Motivation

We're available at service all the time, to give our valued guests with a enjoyable moment. To fulfil your fellowship needs, we're the bone and only stylish option for you to choose, there may be any reason behind your visit. For fun and excitement, we're popular for bringing some of the stylish call girls. Throughout the megacity, these [Escort Service in Aerocity][1] is one of the largely-rated companion service providers and also proud to serve ultraexpensive quality services to our guests. Come on men; to show your love & passion to your companion now get ready! We make sure to be apprehensive of our terms and programs before you go-ahead.However, you can only move towards sexual pleasure and fun, If you're comfortable with all terms & conditions of our [Call Girls in Aerocity][2]. We know how to negotiate the lust and sexual desire of men; we've been in this business for numerous times and thus. [Aerocity Escorts][3]

[1]: https://www.heenaescortservice.com/call-girls-in-aerocity/ [2]: https://www.heenaescortservice.com/call-girls-in-aerocity/ [3]: https://www.heenaescortservice.com/call-girls-in-aerocity/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21