Suggested problems

Biological Motivation

t is a physician endorsed prescription accessible on the counters you may likewise purchase Xanax on the web . There are a ton of sites and messenger organizations giving this drug with next to no solution. Thus, you may likewise [order Xanax online][1] with no solution. Buying Xanax online will without a doubt set aside your cash and time. The counter sell of Xanax isn't accessible wherever yet online request of Xanax will give you ensured home conveyance.

[1]: https://buyxanaxsonlineovernight.mystrikingly.com/blog/buy-xanax-online-overnight-delivery-at-best-price-xanax-online-without

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21