Suggested problems

Buy Anavar Tablets | Anavar For Sale in USA, UK & Australia

Feb. 8, 2022, 1:54 p.m. by annebell

Biological Motivation

Buy Anavar tablets (Oxandrolone) for body building in USA, UK & Australia at best price. Get discount + free shipping + fast & free delivery, Credit Card / bitcoin payment on Anavar for sale online @Buyanavarforsale.com. https://buyanavarforsale.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21