Feb. 8, 2022, 1:54 p.m. by annebell
Biological Motivation
Our Medicnes is a one-stop-shop to cater to all your medication needs. Be it brand or generic medicines you are searching for, Our Medicnes has an exhaustive inventory https://ourmedicnes.com/
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
