Feb. 8, 2022, 1:53 p.m. by annebell
Biological Motivation
Unitedmedicines is the best place to buy Generic Medicine Online with like ED, pain relief etc with Easy Return and 24x7 Support in USA, UK & Australia. https://unitedmedicines.com/
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
