Feb. 8, 2022, 1:19 p.m. by bilal
Biological Motivation
Our islamabad Call Girls are not just for show.[url=https://islamabadescortsgirls.website/]islamabad girl sex[/url] They also offer services that will make your time together exciting and unforgettable. With an escort by your side,
[url=https://islamabadescortsgirls.website/]call girls rawalpindi[/url] boredom would be non-existent.
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
