Suggested problems

How to Fix Installation Error in Avira Antivirus?

Feb. 5, 2022, 6:11 p.m. by Quick Techy

Biological Motivation

A few of the Tips and Tricks are as follows:

Avira Antivirus is considered one of the best antiviruses out there when it comes to virus protection of your computer systems in the economic section. But few users find it difficult to install due to some of the installation errors. Today we are here with a few of the tips and tricks which can help rectify and correct the installation process without any hassle.

Read more - [How to Fix Installation Error in Avira Antivirus][1]?

[1]: https://quicktechy.co.uk/how-to-fix-installation-error-in-avira-antivirus/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21