Suggested problems

Top MS Universities in USA | Best Universities in USA for MS

Feb. 3, 2022, 12:14 p.m. by Study in USA

Biological Motivation

https://www.sixsigmaedu.com/blog/top-ms-universities-in-usa/

Find top MS universities in USA. Rank list of Best Universities in USA for MS. Compare tuition, acceptance rates, student life, Scholarships and more.

MS in USA for Indian Students Top Universities in USA for MS Best Universities in USA for MS Universities in USA for MS Top MS Universities in USA

Top MS Universities in the USA. The United States is a dream country for many students who want to complete their masters abroad. The world’s top universities are in the USA. The facilities are top-notch, and the cutting-edge technologies will ensure you lead to success. Masters in the USA mainly consist of Science, Technology, Engineering and Management combined as STEM. If you are looking for admission to one of the top universities in the USA for MS, you are in the right place.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21