Feb. 3, 2022, 10:34 a.m. by Study in USA
Biological Motivation
Compare the Top Universities in USA. Check out the USA University Rankings based on quality of education, Scholarships, affordability, and alumni success.
Top Universities in USA Best Universities in USA Top 10 Universities in USA USA University Rankings Top 100 Universities in USA
Study in USA for Indian Students. As a diverse country, the United States is a safe place for international students, especially those from India. The study in USA for Indian students will be considered as the best study abroad destination. There are many opportunities available to study in USA for Indian students. Universities in the US can provide the best platform for Indian students who want to study higher education. A major advantage of studying in USA for Indian students is that there are a variety of study options available. Throughout the education system, students receive a variety of coursework that provides both practical experiences and theoretical learning. Additionally, it enables you to experiment with a variety of subjects before committing to one. Classes are structured in such a way that the students can create their curriculum, depending on what interests them the most. With, Study in USA for Indian students can live a glistening life and have a variety of career opportunities.
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21