Suggested problems

Upcoming Residential Apartments For Sale In Bangalore

Feb. 1, 2022, 10:53 a.m. by Brigade Komarla Heights

Biological Motivation

[Brigade Komarla Heights][1] is a premium property designed as a preferred two and three bedroom luxury home. This elegant hotel features more than 320 apartments on 4 acres. This luxurious hotel is located in Padmanabhanagara because we all know the importance of this area in the city of Bangalore. South Bangalore is best suited for residential areas, with fewer information and business centers and a relaxed atmosphere.

[1]: https://www.brigadekomarlaheights.net.in/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21