Suggested problems

Certified Cloud Security Engineer Certification Course

Jan. 31, 2022, 1:54 p.m. by Ak3535

Biological Motivation

This [Certified Cloud Security Engineer Certification Course][1] deals with concepts related to cloud security technologies, practices, principles, and frameworks that define vendor-neutral theories. It also helps you with all the practical skill sets that are required configured different cloud applications, including AWS, GCP, and Azure, that define vendor-specific theories.

[1]: https://securiumsolutions.org/courses/certified-cloud-security-engineer-course/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21