Suggested problems

How to do Gmail Login Different User Temporary?

Jan. 27, 2022, 8:25 a.m. by gerrymax

A Rapid Introduction to Molecular Biology

Figure 1. A 1900 drawing of onion cells at different stages of mitosis by Edmund Wilson.

Making up all living material, the cell is considered the building block of life. The nucleus, a component of most eukaryotic (nonbacterial) cells, has been known to be the hub of cellular activity for 150 years. Seen under a light microscope, the nucleus appears to simply be a darker region of the cell, but as we increase magnification, we find a hodgepodge of substances in the nucleus, which undergoes a flurry of activity leading up to and during mitosis, or cell division; see Figure 1.

...

Problem

You will need to register or create a new account if you are a first-time user. Otherwise, you can use your previous login details to log in on Gmail's different user temporary page. The easiest way to log in with another account to Gmail is through an app and entering your Gmail login different username and password. First, launch the Gmail app on your device. Then, tap on the circular profile icon in the top right corner and choose the 'Add another account' option. Now, you will find the option to add another account from Google. If you are using Gmail, add your Gmail account and verify your identity that this account belongs to you. You will now add another Gmail account by entering your email address and password. Read also - https://contactforservice.com/log-into-gmail-with-multiple-user/

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21