Suggested problems

The Latest Trend In Regal Keto.

Jan. 26, 2022, 5:58 a.m. by RegalKeto

Biological Motivation

Regal Keto :- In this way, it is vital for meet the models of your body shape and get a fit figure utilizing the dietary fiber supplement Keto to make your body thin. Consequently, an enhancement of Regal Keto pills is there to use. In addition, you can audit all that a client needs to satisfy to cause the enhancement better for wellbeing and to consume layers of fat rapidly. By and large, attempt to check the advantages and disadvantages of Regal Keto diet pills and afterward use them.

https://www.mynewsdesk.com/healthyworldstock/pressreleases/regal-keto-reviews-2022-a-secret-wants-to-rapid-fat-loss-proffers-wholesomeness-and-nutritive-values-3156838

https://www.facebook.com/Regal-Keto-109746994947566

https://promosimple.com/ps/1b06e/regal-keto

https://r2.community.samsung.com/t5/Galaxy-A/Regal-Keto-Tested-2022-Pills-Price-Reaction-Before-Buy/m-p/10648595#M402182

https://www.tickaroo.com/ticker/61e8dc5831d52f143dccd1fc

https://regalketo2201.jimdosite.com/

http://healthwebcart.com/regal-keto/

https://regal-keto-price.jimdosite.com/

https://regal-keto-reviews-2.jimdosite.com/

https://twitter.com/Regal_Keto

https://www.instagram.com/p/CY7PGmyhhOs/

https://www.pinterest.com/pin/909797562194923061/

https://www.facebook.com/Regal-Keto-103542578903704

https://www.tumblr.com/blog/view/regalketoprice

https://sites.google.com/view/regal-keto-offer/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21