Suggested problems

Biological Motivation

that the Protonmail account temporarily unavailable, then this is because there is anything that looks like an attempt by an attacker to access your account. Protonmail's security system will automatically identify and flag it. When you are at high risk, Protonmail may also temporarily lock your account to prevent the attacker from accessing it. Further, a corrupt browser cache is often the cause of this problem. Therefore, you should clear the browser's cache and restart the browser. Also, you may need to change your domain if you want Protonmail to accept your account else it will restrict users from logging into their accounts.

Visit for more detail https://contactemail.us/cannot-login-to-protonmail/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21