Suggested problems

How to Change Yahoo Password on iPad?

Jan. 22, 2022, 8:50 a.m. by gerrymax

Biological Motivation

Occasionally, you might need to change the password of your account. Now, the question is: [how to change password Yahoo Mail on the iPad][1]? It's quite straightforward. In order to change the Yahoo Mail password, simply log in to your Yahoo Mail account and go to the 'Security page.' Then, tap on the 'Change password' option to change the Yahoo Mail password. Now, enter a new password and if asked, confirm it. Finally, tap on the 'Continue' button to save the settings. You'll now be able to log in to Yahoo with this new password.

[1]: https://contactforservice.com/how-to-change-yahoo-password/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21