Suggested problems

Avail tech support service- how to take Fake cash app balance screenshot

Jan. 19, 2022, 12:48 p.m. by jhonsaddy

Biological Motivation

Are you having issues with [Fake cash app balance screenshot][1]? Don’t know how to solve the glitches instantly? In case of any kind of technical hassle, consider contacting the techies. Experts can resolve the woes instantly. Also, they help in providing instant removal of the problems.

[1]: https://www.7qasearch.net/blog/fake-cash-app-screenshot-balance-generator/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21