Suggested problems

Online IT Training: ERP/SAP Online Training | JAVA Online Training | C++Online Training | ORACLE Online Training | Python Training | Machine Learning Training.

Jan. 18, 2022, 11:49 a.m. by NextIT

Biological Motivation

Online IT Training: ERP/SAP Online Training | JAVA Online Training | C++Online Training | ORACLE Online Training | Python Training | Machine Learning Training. If you Need more Details and Information Regarding IT Online Training. Please Visit: NextIT Vision- Best IT Training in INDIA Website- www.nextitvision.com Email- info@nextitvision.com Whatsapp / Call - +91 – 7827606564 Disclaimer - https://www.nextitvision.com/disclaimer/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21