Jan. 17, 2022, 7:25 a.m. by anabelle bailey
Biological Motivation
The most significant factor is the management of the social media platform. People must, however, be allowed to select the platform via which they can contact the Facebook customer service staff. This is critical to quickly resolve unexpected problems. Facebook is simple to use, and users may connect with people all around the world. As a result, they must have their social media accounts reviewed by a customer care representative. https://www.7qasearch.net/facebook-support-phone-number/
...
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
