Suggested problems

How To Avail Cash App Customer Service If Recently Joined Cash App?

Jan. 17, 2022, 5:14 a.m. by petter7

Biological Motivation

No matter whether you have join the Cash App account recently or you have been using the Cash App services for long time, you must be aware of how to avail [Cash App Customer Service][1]. To get the support from Cash App department, you have to go to the official support section at anytime.

[1]: https://www.cash-app-helps.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21