Suggested problems

Returns and Cancellations of Trend Micro Antivirus

Jan. 16, 2022, 9:15 p.m. by Quick Techy

Biological Motivation

What is your refund policy?

Trend Micro Antivirus is one of the best antiviruses that is launched by Digital River. It offers a 30-days money-back guarantee if you do not want to continue with Trend Micro Services in the future.

How do I cancel before I am automatically renewed?

Your order will be auto-renewed because this is the default operation of every antivirus whichever you are using. If you want to cancel your auto-renewal plan, you need to see your order and click on Stop Automatic Billing.

Read full Article - [Returns and Cancellations of Trend Micro Antivirus][1]

[1]: https://quicktechy.co.uk/how-to-stop-auto-renewal-and-get-trend-micro-antivirus-refund/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21