Jan. 14, 2022, 11:57 a.m. by iamsharma
Biological Motivation
We are an online e-learning platform that gives students study material NCERT solutions also to CBSE-NCERT students for class 11 based on the latest edition of the ncert book for physic, chemistry, maths & biology subjects. For more info- https://www.entrancei.com/ncert-solutions-for-class-11 Contact us- 011-47340170
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
