Suggested problems

ENTRANCEI- NCERT Solutions For Class 11 Science All subjects with latest edition

Jan. 14, 2022, 11:57 a.m. by iamsharma

Biological Motivation

We are an online e-learning platform that gives students study material NCERT solutions also to CBSE-NCERT students for class 11 based on the latest edition of the ncert book for physic, chemistry, maths & biology subjects. For more info- https://www.entrancei.com/ncert-solutions-for-class-11 Contact us- 011-47340170

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21