Suggested problems

Jade Face Roller Facial Massager Roller Skin Eye Roller

Jan. 13, 2022, 10:39 a.m. by jaderoller

Biological Motivation

Introducing the Real Face Roller Skin Care Set By LeiCare! Now you don’t have to settle for flimsy beauty tools that fall apart soon, noisy facial massager tools, or [gua sha][1] stone tools that arrive cracked. This real jade roller face massager set by LeiCare will help you rediscover your healthy, youthful, and glowing face.

Jade Roller: Invigorate your dull or tired complexion. Are you ready for a rejuvenating facial massage? Boost the blood circulation in your face, even its tone, and put a pause to face puffiness with a high-end face massager roller. Face Roller: Lift and sculpt your facial features. Relieve tension in your face muscles, tighten and brighten your skin. Our face roller massager encourages lymphatic drainage to banish bloat and leaves your face with a healthy glow. Gua Sha: Get a great value jade roller and gua sha set. Made of 100% natural quartz stone. This 2-in-1 facial skin care products kits is ideal if you don't want to choose between a jade face roller and a gua sha tool for face. Get all the benefits of both massage tools for your skin care routine. How to Use a Face Roller and Gua Sha: Clean the jade facial roller and Gua Sha Stone before and after, prep clean skin on your face by applying skin care products. Recommend twice a day, jade rolling and scraping in the morning and in the evening. Leave your jade facial roller in the fridge for 15-20 minutes and enjoy the cooling effects of an ice roller set. Reduce under-eye bags, fine lines, and wrinkles in no time. The Ideal Birthday Present: Our gua sha and jade roller packed in a pretty gift box for you. An ideal present for mom or friends. Add our gua sha roller set to your skin care routine.

The face roller jade is designed to help improve the skin and circulation, helps you regain the smooth, youthful skin you’ve lost over the years. Jade stone roller also helps enhances skin elasticity to remove the visibility of wrinkles, fine lines and other signs of aging while promoting a complexion with a youthful glow, so that your skin looks and feels young again. The quartz roller feels cool that has a soothing and relaxing effect on the skin. You can place the quartz roller in the fridge overnight to give yourself a cool relaxing effect and relieve facial tension. Jade Roller - Rolling a jade facial roller on the skin or eyes helps to remove toxins, reduces wrinkles and fine lines, tightens your skin. Regular use of face roller massager improves skin circulation, preserve skin's elasticity, leading to fading the aging signs. Face Roller - The smooth rose quartz face roller feels calm and pleasant on your skin. It glides slickly without pulling and tugging your skin. The larger roller is for the forehead, jawline, neck and cheek, while the smaller roller is designed for eye massage. [Jade Face Roller][2] - Face massager roller relaxes facial muscles and relieves stress and pressure. In the long run, it maintains a smoother and youthful complexion, helps you regain glowing skin you've lost to time. How to Use a Jade Roller - Clean the jade roller before and after, prep clean skin on your face by applying skin care products. We recommend twice a day, jade rolling in the morning and in the evening. Put the jade skin roller in the fridge for a few minutes for ice rolling. The Ideal Birthday Present - Our facial roller packed in a pretty gift box for you. An ideal present for mom or friends. Add our facial massager roller to your skin care routine. We firmly believe quality of our quartz face roller and we prioritize satisfaction of our customers before anything else.

[1]: https://www.leicare.com/collections/jade-face-roller-gua-sha [2]: https://www.leicare.com/collections/jade-face-roller-gua-sha

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21