Suggested problems

Das Ziel ihrer Traumhochzeit zu finden war einfach

Jan. 13, 2022, 12:44 a.m. by mekleid

Biological Motivation

Jenn und Alex haben die modernste Hochzeit mit Blick auf das Rhode Island Sea geplant! Von einer trendigen Farbpalette bis hin zu Jenns atemberaubendem Stella York-Kleid ist diese Hochzeit voller stilvoller Details, die Sie an Ihrem großen Tag nachahmen möchten. Lesen Sie ihre Liebesgeschichte: ​

The Fines haben sich im August 2018 am Strand von Newport, Rhode Island, verlobt. „Meine Eltern sind nach Newport gezogen und unsere beiden Familien haben es geliebt, die Sommerwochenenden dort zu verbringen. Newport ist für uns beide so besonders und die Verlobung und Heirat dort ein Jahr später war SO unglaublich!

Das Ziel ihrer Traumhochzeit zu finden war einfach, aber Jenns Traumkleid zu finden stellte sich als etwas mehr Arbeit heraus. „Ich wusste [cocktailkleider][1] kurz, dass ich ein figurbetontes und bequemes Kleid haben wollte“, sagte Jenn. „Ich habe in 4 verschiedenen Brautmodengeschäften mehrere verschiedene Silhouetten anprobiert. Nachdem ich verschiedene Styles anprobiert hatte, verliebte ich mich in ein herzförmiges Dekolleté. Stella Yorks # 6814 war alles, wonach ich gesucht habe! Jenn wusste, dass sie dieses hier gefunden hatte – modern, sexy, romantisch, voller wunderschöner Spitze und mit ihrem Lieblings-Dekolleté!

[1]: https://www.mekleid.de/cocktailkleider-g19

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21