Suggested problems

Best Motivation Speaker in Raleigh

Jan. 10, 2022, 12:22 p.m. by martinwoodard

Biological Motivation

To sustain yourself as a motivational speaker, there are a few things you need to be conversant with. In order to be the best motivational speaker in Raleigh, be aware of your area of expertise and know your target audience so as to know those who would benefit from hearing you speak. Having an in-depth understanding of what you want to say as a motivational speaker is important. However, learning how to deliver it is quite essential too. So, you need to invest enough energy and time into improving your speaking skills.

[https://martinwoodard.com/][1]

[1]: https://martinwoodard.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21