Suggested problems

Aboutyears and the firstyears of that

Jan. 9, 2022, 7:51 a.m. by Jacquelin C. Navarra

Biological Motivation

Aboutyears and the firstyears of that I was practicing conventional psychiatry https://nutradiary.com/nootrogen/">Nootrogen prescribing medications and offering psychotherapy combining those two and then for the pastyears I've focused more and more on nutritional psychiatry and that's what I've been doing now exclusively for a couple of years now so this is really a very exciting Nold. [url=https://nutradiary.com/nootrogen/]https://nutradiary.com/nootrogen/[/url]

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21