Suggested problems

free ost to pst converter software

Nov. 24, 2021, 4:28 a.m. by romastella

Biological Motivation

Stella [outlook ost conversion software][1] is the amazing software to convert all the ost file data in to pst file. stella outlook ost conversion software support all the version ost file. stella outlook ost conversion software convert 32bit and 64bit damage ost file data in to office 365 account. Stella outlook ost conversion software convert deleted items data in ost file. this software can handle any corruption of the ost file. for more info visit this link https://www.stelladatarecovery.com/ost-to-pst-recovery.html

...

[1]: https://www.stelladatarecovery.com/ost-to-pst-recovery.html

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21