Suggested problems

Why did a how to get random money on cash app?

Nov. 23, 2021, 11:05 a.m. by stuardboard

Biological Motivation

If you are wondering that why did a random person sent me money on cash app? Then it is the high chance that it could be a potential scam against your Cash app confidential details. If someone has sent you money on the Cash app by mistake then, definitely, you will have to send that money to the sender’s Cash app account. But you must not hurry in refunding that money back to the sender's account. You can tap on the link here to learn more. https://www.emailsupport-contact.com/blog/how-to-get-random-money-on-cash-app/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21