Suggested problems

Hire vetted quality TypeScript developers within 48 Hours

Nov. 22, 2021, 5:16 a.m. by OptymizeA

Biological Motivation

Optymize offers to hire top 5% remote engineers within 48 hours to scale startups/product development teams Hire vetted quality TypeScript developers within 48 Hours Fortune 500 companies and funded startups pick Optymize’s TypeScript developers to scale up their teams quickly and to achieve their project deadlines. Extend your technology team and select the top 5% TypeScript developers on contract basis. Optymize is a marketplace for top TypeScript developers, programmers, consultants pre-vetted by our experts and our Talent Cloud Solution. Hire top 5% freelance Spring Boot developers How to hire Spring Boot Developers through Optymize 1. Quick Call: Optymize Director of Engineering will have a quick call with you to better understand your business goals and technical needs. 2.48 Hour Sourcing: Get matched with experience-driven pre-vetted talent within 48 hours of the call. 3. Review and onboard: Interview shortlisted candidates and onboard your optimal hire under 2 weeks with a risk-free trial. Pay only if you are satisfied. How are Optymize Spring Boot developers different? At Optymize, our specialized team of technical experts assesses Spring Boot developers through a rigorous vetting process including customized coding tests designed specifically based on your requirements to make sure you get only the right talent. Potential candidates are then tested for communication skills and team dynamics to ensure we only match you with the talent of the highest calibre. Adding a top Spring Boot developer with excellent communication skills and who is also a team player will increase team output substantially. We believe in providing top-quality Spring Boot developers only. Join us at: https://optymize.io/hire-spring-boot-developers/ https://optymize.io/hire-typescript-developers/ Built your career through freelancer jobs for innovative companies Join a network of remote freelancers and work with high-growth companies to get better compensation, more work flexibility, and mastery over your skills. visit at: https://optymize.io/freelancer/

...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21