Suggested problems

How long does Google account recovery take?

Nov. 18, 2021, 5:43 a.m. by ryan burgers

Biological Motivation

Do you want to know how long does [google account recovery][https://google.monktech.us/account-recovery.html] take? Then you have come to the right place to know the time period that a google account recovery procedure will take? To know about this you just have to click on this given link and after clicking that given link it is a matter of just a few seconds only for you to know the time that a recovery procedure takes.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21