Suggested problems

What is Cash App Phone Number?

Nov. 17, 2021, 9:09 a.m. by Square Cash Helps

Biological Motivation

Cash App is super popular payment app in the USA. But, still, it is not free from a broad range of issues. Cash App payment failure, delay in direct deposit, missing refund, and accidental payments are some of the most nefarious issues on Cash App. That's the reason why a large number of people could be seen asking how to do Cash App dispute? Gladly, there is more than one way to start dispute on Cash App for any kind of issue. Whether you are concerned about Cash App refund or safety related concern, either you can use your Cash App mobile application or dial the [Cash App phone number][1].

[1]: https://www.squarecashelps.com/blog/cash-app-phone-number

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21