Suggested problems

Blog Tiền Tỷ

Nov. 16, 2021, 2:15 a.m. by Blog Tiền Tỷ

Biological Motivation

Blog Tiền Tỷ Trang review các ứng dụng website kiếm tiền online uy tín nhất trên thị trường MMO website: https://blogtienty.com . Ngoài ra Blog Tien ty cung cấp thêm các dịch vụ liên quan Paypal: hỗ trợ các bạn rút tiền paypal dưới 10$. Mua bán thẻ cào, thẻ game bằng số dư paypal. Chuyển tiền từ nước ngoài về việt nam. Rút tiền từ các tựa game hỗ trợ kiếm tiền bằng Paypal. Các bạn có thể tham khảo những video chi tiết tại kênh Youtube: Ha Tam Official và Ma Xa Mi Xem chi tiết bài viết hướng dẫn rút tiền paypal dưới tại đây:https://blogtienty.com/rut-tien-paypal-duoi-10usd/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21