Suggested problems

My blogging

Nov. 15, 2021, 9:57 p.m. by charles

Biological Motivation

My Blogs https://sites.google.com/a/brandnfits.com/aacomflightchange/home">aa.com/flightchange https://sites.google.com/a/brandnfits.com/appstore-com-redeem/appstorecomredeem" rel="dofollow">appstore.com/redeem https://sites.google.com/site/canoncomijsetupcanon/ij-start-canon" rel="dofollow">ij.start.cannon https://sites.google.com/site/installaoldesktopgolddownload/home" rel="dofollow">install aol desktop gold https://sites.google.com/site/fubotvconnect" rel="dofollow">fubo.tv/connect https://sites.google.com/site/hp123comsetuphp/home" rel="dofollow">123.hp.com/setup https://sites.google.com/site/hp123comsetuphpdriver/" rel="dofollow">123.hp.com/setup https://sites.google.com/site/123hpcomsetupdownload/" rel="dofollow">123.hp.com/setup https://sites.google.com/site/huluactivate1/" rel="dofollow">hulu.com/activate https://sites.google.com/site/huluactivationcodefortvv/hulu-comactivate-enter-hulu-activation-code" rel="dofollow">hulu.com/activate https://sites.google.com/site/enterhulucomactivation/" rel="dofollow">hulu.com/activate https://sites.google.com/view/aoldesktopg0ld/aol-desktop-gold" rel="dofollow">install aol desktop gold https://amazonmytv-activate.com/">www.amazon.com/mytv https://amazonmytv-activate.com/www-primevideo-com-mytv/">www.primevideo.com/mytv http://hbomaxcomtv-signin.com/">hbomax.com/tvsignin http://hbomaxcomtv-signin.com/tvsignin/">hbomax.com/tvsignin enter code https://www.amazn-mytv-activate.com/" rel="dofollow">www.amazon.com/mytv https://sites.google.com/site/hp123comsetup123/">123.hp.com/setup https://sites.google.com/view/fub0tv-connect/" rel="dofollow">fubo.tv/connect https://sites.google.com/a/brandnfits.com/applecomrecover/iforgot-apple-com" rel="dofollow">iforgot.apple.com https://sites.google.com/a/brandnfits.com/iforgotapplecom/" rel="dofollow">iforgot.apple.com https://sites.google.com/brandnfits.com/disneypluscombegin/" rel="dofollow">disneyplus.com/begin https://sites.google.com/brandnfits.com/bravotvcomlink/" rel="dofollow">bravotv.com/link https://sites.google.com/view/mcafee-comactivation/" rel="dofollow">mcafee.com/activate https://sites.google.com/a/brandnfits.com/yahoomailsignin/" rel="dofollow">yahoo mail signin https://sites.google.com/a/brandnfits.com/amazon-co-uk-mytv/primevideo-com-mytv" rel="dofollow">amazon.co.uk/mytv https://sites.google.com/brandnfits.com/hbomaxcomtvsignin/" rel="dofollow">hbomax.com/tvsignin https://sites.google.com/brandnfits.com/hbomaxcomtvsignin/tvsignin/">hbomax.com/tvsignin https://sites.google.com/view/huluactivation-code/hulu-comactivate" rel="dofollow">hulu.com/activate https://sites.google.com/brandnfits.com/hbomaxcom-tvsignin/" rel="dofollow">hbomax.com/tvsignin https://sites.google.com/view/activateyout/" rel="dofollow">youtube.com/activate

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21