Suggested problems

NATURE'S NUTRITION APPLE CIDER VINEGAR, BENEFITS, USES, WORK, RESULTS & WHERE TO BUY?

Nov. 15, 2021, 11:23 a.m. by ashmin67

Biological Motivation

... Nature’s Nutrition Apple Cidar Review

Dietary supplements for weight loss are in great demand in various parts of the world. Due to the presence of various nutritional supplements in such a classification, it is inconvenient for a man to choose the best product for weight loss problems. This article will educate you on the perfect answer for you which is known as Nature’s Nutrition Apple Cidar from Viegar. It offers the best results for your body without any terrible symptoms. The reason it is effective is because it contains Nature’s Nutrition Apple Cidarand forskolin.

More Link TO Visit:-

https://sites.google.com/view/applecidervinegarbuy

https://healthywellbeing55.blogspot.com/2021/11/natures-nutrition-apple-cider-vinegar.html

https://r2.community.samsung.com/t5/other/NATURE-S-NUTRITION-APPLE-CIDER-VINEGAR-BENEFITS-USES-WORK/m-p/10070531#M7825

https://caramellaapp.com/soniasonia/4oHqsKDne/nature-s-nutrition-apple-cider

https://forum.mineland.net/en/index.php?threads/natures-nutrition-apple-cider-vinegar-benefits-uses-work-results-where-to-buy.5909/

https://www.completefoods.co/diy/recipes/natures-nutrition-apple-cidar

https://www.homify.in/users/8790526/sinhasonia955

https://natures-nutrition-apple-cider.jimdosite.com/

https://dribbble.com/shots/16848729-NATURE-S-NUTRITION-APPLE-CIDER-VINEGAR-BENEFITS-USES-WORK-RE

https://sinhasonia955.wixsite.com/apple-cider

https://apple-cider.mystrikingly.com/

https://www.facebook.com/Apple-cider-vinegar-101525495692736

https://www.facebook.com/Natures-Nutrition-Apple-Cider-Vinegar-105034281994060

https://www.provenexpert.com/apple-cider-vinegar/

https://promosimple.com/giveaways/natures-nutrition-apple-cider-vinegar/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21