Suggested problems

Cash App - The easiest way to send/receive, spend, banking, and invest in 20212

Nov. 12, 2021, 4:56 p.m. by ElizaKhan420

Biological Motivation

Cash App is an application that allows peer-to-peer payments directly from your mobile device. Cash app users can get an optional Visa debit card that allows them to use funds in the cash app account and even withdraw cash from ATMs. You must have a valid bank account associated with your Cash App to transfer funds. For more details, please visit site. https://techz65.online/

Problem

Cash App is an application that allows peer-to-peer payments directly from your mobile device. Cash app users can get an optional Visa debit card that allows them to use funds in the cash app account and even withdraw cash from ATMs. You must have a valid bank account associated with your Cash App to transfer funds. For more details, please visit site. https://techz65.online/

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21