Suggested problems

https://www.facebook.com/Turbo-Heater-3-US-UK-Canada-102885148871692

Nov. 3, 2021, 10:08 a.m. by healthvilla12

Biological Motivation

Turbo Heater 3 Specifications (Turbo Heater 3 Review US)

Here are some technical facts that make Turbo Heater 3 a top notch and must-have especially in countries like Canada, US, UK, etc.

Innovative Design 3 Seconds Fast Heating 600W Power with 3rd Gen Hot-Free Body New Energy Saving Technology Adjustable Temperature (65-90°F / 18-32°C) 0Overheat Protection Tilt and Child Protection Automatic Timer (1-12 Hours) Ultra Quiet Portable 10 inches / 26 cm Height. Where can I get a turbo 3 heater? This device is only available on the official website. You can't find it anywhere just on the website. You should be wary of scammers asking you to send them money for any reason. This device can only be purchased directly from the official website. You can place an order via the link in this article.

VISIT HERE FOR MORE INFORMATION:

[https://www.urhealthbooster.com/news/turbo-heater-3-review/][1]

[https://turboheater3.blogspot.com/2021/11/turbo-heater-3-review-price-benefits.html][2]

[https://sites.google.com/view/turbo-heater-3/][3]

[https://www.facebook.com/Turbo-Heater-3-US-UK-Canada-102885148871692][4]

[https://medium.com/@healthvilla12/turbo-heater-3-review-price-benefits-2021-d0b779b9180b][5]

[https://dribbble.com/shots/16778321-Turbo-Heater-3-Review-Is-Turbo-Heater-3-is-Scam-or-Legit][6]

[https://za.pinterest.com/pin/1024287508971307624][7]

[https://site-5408328-567-3949.mystrikingly.com/blog/turbo-heater-3-benefits][8]

[https://turboheater3.mystrikingly.com][9]

[https://caramellaapp.com/healthvilla12/6llf-W3tc/turbo-heater-3][10]

[https://healthvilla12.wixsite.com/turbo-heater-3][11]

[1]: https://www.urhealthbooster.com/news/turbo-heater-3-review/ [2]: https://turboheater3.blogspot.com/2021/11/turbo-heater-3-review-price-benefits.html [3]: https://sites.google.com/view/turbo-heater-3/ [4]: https://www.facebook.com/Turbo-Heater-3-US-UK-Canada-102885148871692 [5]: https://medium.com/@healthvilla12/turbo-heater-3-review-price-benefits-2021-d0b779b9180b [6]: https://dribbble.com/shots/16778321-Turbo-Heater-3-Review-Is-Turbo-Heater-3-is-Scam-or-Legit [7]: https://za.pinterest.com/pin/1024287508971307624 [8]: https://site-5408328-567-3949.mystrikingly.com/blog/turbo-heater-3-benefits [9]: https://turboheater3.mystrikingly.com [10]: https://caramellaapp.com/healthvilla12/6llf-W3tc/turbo-heater-3 [11]: https://healthvilla12.wixsite.com/turbo-heater-3

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21