Suggested problems

I love sex dolls more than computers

Nov. 3, 2021, 9:30 a.m. by KevinMille

Biological Motivation

A 1904 French document "Les Detraquees de Paris" (Les Detraquees de Paris) records the appearance of realistic sex dolls in detail. The book records that Dr. P showed him the sex dolls he created. These dolls are lifelike and can be inflated and heated. The production cycle of each doll is 3 months, and the price is about 10,000 francs.

https://www.oksexdoll.com/

Dr. P also said that the three-month work will include a well-designed inner frame, head and body hair, teeth and nails, skin coloration, vein patterns, eyes and tongue. He also clarified the reason for his anonymity: "Unfortunately, I can't publicize it publicly. The police have been interfering with my business, and I had to put some fat sex doll near here, so that I can say that I am a deed. The person who made the inflatable model at the fund show."

For most of Western history, attempts to copy human images, especially for sexual purposes, will be regarded as blasphemous and will undoubtedly be punished by law. In the East, human models cannot be made casually, and serious cases may be regarded as arrogant.

https://www.oksexdoll.com/tpe-sex-dolls.html

In the study of these French records discovered, it can be seen that the silicone sex doll making technology at that time was already very advanced, the appearance was lifelike, and the function could even imitate ejaculation. Although these research projects have been kept underground, their technological development has been very rapid.

According to the documents that have been discovered, at least in 1922, sex dolls have already had a pronunciation function. Just like the selfless and harmonious atmosphere in the forum, other countries on the European continent have said to the French: "A good person lives in peace." Because France does not monopolize this technology, but allows it to spread widely. Since then, sex dolls have not only bloomed everywhere in France, but Germany, Austria and other countries have also begun to imitate them. However, Germany's is the cheapest and Austria's is the most expensive.

https://www.oksexdoll.com/ai-robot-sex-doll-for-sale.html

But so far, people still secretly put TPE love doll in private to enjoy, but not long after a famous artist showed the dolls publicly for the first time, this person is Oscar Kokoschka.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21