Suggested problems

Join the Amitabh Bachchan NFT release and place your bid

Nov. 1, 2021, 10:16 a.m. by Balakrishnan

Biological Motivation

Being one of the veteran actors, Amitabh also holds the pride of being the pioneer in entering the [NFT marketplace][1] with his unique collections of arts, movie posters, and many undisclosed collections, which will act as surprises. Since the launch date of Amitabh NFT is nearing, don’t miss out on registering for the auction, which will be live on BeyondLife.club.

[1]: https://www.beyondlife.club/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21