Suggested problems

What happens if negative balance on the Cash App?

Nov. 1, 2021, 9:47 a.m. by smith johnson

Biological Motivation

negative balance on the Cash App appears on your Cash app account when your account has an insufficient amount of funds. If your Cash app account lacks sufficient money to cover the late changes then it will go in negative balance. To solve the problem of negative balance, you can either replenish your cash app card or contact to Cash app customer care. Make sure you click on the link here so that you can easily know the exact ways to solve this issue.

[https://www.contactmail-support.com/blog/how-do-you-fix-the-negative-balance-on-the-cash-app/ negative balance on the Cash App][1]

[negative balance on the Cash App][1]

[1]: https://www.contactmail-support.com/blog/how-do-you-fix-the-negative-balance-on-the-cash-app/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21