Suggested problems

What is the way to activate cash app card?

Nov. 1, 2021, 9:24 a.m. by smith johnson

Biological Motivation

If you are a cash app user and looking to activate cash app card then it is the place that you want. You can [activate your cash app card][https://www.cashappmonks.com/blog/how-to-activate-cash-app-card/] here very easily with just a click all you have to do is just clicking on the given link.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21