Suggested problems

Are you finally ready to plunge into the world of cryptocurrencies?

Oct. 29, 2021, 3:08 a.m. by tispisofye

Biological Motivation

This may seem like a difficult decision, but after a little training, beginners can buy and sell bitcoins in no time.

Bitcoin is the most common digital currency on the market. You can buy bitcoins in fractional amounts, even if you are not too rich. However, before you buy a piece of bitcoin pie, you need to do a few things. This includes:

You also need to study the market, realizing that cryptocurrencies - and bitcoin in particular - can be unstable, dramatically changing the value from one day to the next. Keeping this in mind, never invest more than you can afford to lose when buying cryptocurrency. Before buying a digital currency, you need a place to store it, and this is where crypto wallets appear. They are known by several names - hot wallet, hardware wallet, software wallet.

If you want to use a digital wallet, most major cryptocurrency exchanges combine an online wallet with your account.

If you use a software wallet (also known as a hosted wallet, since it is hosted on third-party servers), you simply create an account with a username and password and enable two-factor authentication. If you set up your wallet as part of a cryptocurrency exchange account and this exchange uses KYC, you will need to provide documents such as a driver's license to verify your identity. Non-storage hot wallets are not serviced by a third party and take more security measures than a standard hot wallet. Users receive a randomly generated "private key" or "seed phrase" that they can use to access the wallet. These keys usually consist of 12 words and are known only to the user. It is recommended to store this passphrase in a secure and offline place - it is harder to crack this way. But if you lose the phrase, you will lose your own wallet.

Cold wallets also generate a keyword known only to the user that allows access to the wallet. This keyword is usually a string of 24 randomly generated words, and you will also create a PIN to gain access. Cold wallets work together with applications and software on your smartphone or desktop device, so you will install them as needed when setting up a cold wallet.

A paper wallet is a type of cold wallet in which the public and private keys required for a transaction are printed on a piece of paper for an additional security measure. A transaction cannot be made without information on a piece of paper that is created online and then can be printed. They are more often used for long-term or highly reliable investments, they are intentionally slower to use than other types of cryptocurrency wallets.

Regardless of what type of wallet you use, you need to link a payment method to it for purchases. It can be a bank account or a payment service. When sending payment information, you need to confirm your identity.

Once you select a wallet and set it up, it's time to find an exchange and make your first bitcoin transaction.

You will need to do some homework to determine which exchange is best suited to your needs. Since bitcoin is the original and most popular cryptocurrency, you can be sure that all of the above exchanges will offer transactions with this currency. You can also find out what other cryptocurrencies they offer if you have plans to expand your portfolio.

Study each company and see what measures they take to save people's money. Are they insured? If so, for how much? What security measures do they use? Before proceeding, find out the answers to all these questions.

Whichever exchange you choose, you will need proof of identity when registering - usually a driver's license or a government-issued ID card. You may be asked to provide proof of address and scans of additional documents, such as passport.

Do some research, choose an exchange, set up your account, deposit some cash into it, and you'll be ready to start buying bitcoins.

Now that you are ready to buy bitcoin, go through the process of [how to start learning about cryptocurrency][1] and buying currency as much as you can afford. The process will be different depending on which exchange you use.

Some just have "buy" and "sell" buttons where you specify how much currency you want to buy or sell. In other cases, you send an order similar to a regular exchange. Most cryptocurrency exchanges allow you to buy and sell using three types of orders.

As cryptocurrencies have evolved and gained a certain degree of legitimacy in the eyes of the public, cryptocurrency exchanges have grown with them into something that can be almost equivalent to traditional exchanges. Some will even let you choose the current dollar amount to invest every day, week or month.

Choosing an investment strategy is important for success in investing. A common strategy is to buy and hold bitcoins in the hope of overcoming the ups and downs in valuation and getting a higher average return.

Cryptocurrency can be an exciting investment prospect. A lot of options for using digital currency make it an interesting and tempting option for investment, but every new investor should understand that they are in no way guaranteed a huge profit from investing in cryptocurrency. You are more likely to lose money than become a billionaire overnight, so it's worth repeating: never, ever invest more than you can afford to lose.

[1]: https://bikotrading.com/for-beginners/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21