Suggested problems

Roku Support

Oct. 28, 2021, 5:59 p.m. by Roku1Support

Biological Motivation

In this blog, we are going to discuss how you can activate your Roku, Roku setup and link your Roku in few steps.

[Roku.com/link | Roku activation issues][1] : [Roku com link][2] is used to activate Roku on the device of your choice. For this, you will have to go on to Roku.com/link to enter the activation code. This is an important step if you want to activate your Roku to enjoy streaming content. It is important to link the Roku with a Roku account.

Setup [Roku com Link][3]| Technical Support : To effectively use Roku, you need to set up the Roku device and link your Roku. Here is what you can do for the Roku com link. Go to a web browser of your choice on the smartphone or personal computer. Type [www.roku.com/link][4] in the search bar. This will navigate you to the Roku link page and here is where you will be to link your Roku.

[Roku Support][5] will provide you complete guidance over any queries related to Roku device and its services such as :

[Roku Not Connecting to Wi-fi][6] : What should you do if your Roku is not connecting to Wi-Fi? Seems a little tricky to understand but no worries, this post is customized for you only.

[Roku Error Code 005][7] :Click on the link, we have covered in detail the solutions that can help you with how to fix Roku error code 005.

[Netflix not working on roku][8] : Is your Netflix not working on Roku? The Netflix app may have stopped responding to Roku. Click on the link where we have discussed why Netflix is not working on Roku and how you can fix this issue.

[Roku Error Code 009][9] : Are you facing Roku error code 009? Then, this simply means that your Roku cannot connect with the internet connection. So, if you are having Roku Error code 009 then try contacting Roku technicians for troubleshooting and fixing the issue right there.

[Roku error code 001][10] : If you are coming across a similar issue and are thinking how to fix error code 001 then you are at the right place. Here we have discussed in detail the solutions that can help in fixing the problem.

[Roku Connected But not Working][11] : If in case your Roku device is connected to the Internet, but it’s not working, thus this is the right article for your help.

**[Speaker Pair Help | go.roku.com/speakerpairhelp][12]** : In the given link we have discussed to use the features of the pair wireless speakers for Roku.

[Britbox Not Working on Roku][13] : How to Resolve Britbox not working on the Roku issue? We have discussed this in the given link Britbox Not Working on Roku.

[Hulu Not Working on Roku][14] : When your Hulu app is not working on the Roku streaming device, that means there is some troublesome with the Hulu app. To remove this, read our article Hulu Not Working on Roku

[Xfinity Stream Beta not working on Roku][15] : Is your Xfinity stream beta not working on Roku? No need to worry anything about it. All you got to do is just read this post Xfinity Stream Beta not working on Roku.

[Prime video not working on Roku][16] : In this blog, we have discussed in detail the solutions that can help you fix the problem with Amazon Prime i.e. Prime video not working on Roku.

[How to Activate NFL Game Pass on Roku][17] : How to Activate NFL Game Pass on Roku with the help of this post is easy to understand and know i.e. How to Activate NFL Game Pass on Roku.

To Reach Us : Our experts are readily accessible at [call roku support][18]. They are a well-informed group of professionals who will assist you 24*7 in managing and resolving all your Roku problems. Call us at our toll-free number +1-800-961-7126

https://www.rokucom-support.com">Rokusupport

[1]: https://www.rokucom-support.com/ [2]: https://www.rokucom-support.com/ [3]: https://www.rokucom-support.com/ [4]: https://www.rokucom-support.com/ [5]: https://www.rokucom-support.com/ [6]: https://www.rokucom-support.com/roku-not-connecting-to-wi-fi/ [7]: https://www.rokucom-support.com/roku-error-code-005/ [8]: https://www.rokucom-support.com/netflix-not-working-on-roku/ [9]: https://www.rokucom-support.com/roku-error-code-009/ [10]: https://www.rokucom-support.com/roku-error-code-001/ [11]: https://www.rokucom-support.com/roku-connected-but-not-working/ [12]: https://www.rokucom-support.com/go-roku-com-speaker-pair-help/ [13]: https://www.rokucom-support.com/britbox-not-working-on-roku/ [14]: https://www.rokucom-support.com/hulu-not-working-on-roku-quick-fix/ [15]: https://www.rokucom-support.com/xfinity-stream-beta-not-working-on-roku/ [16]: https://www.rokucom-support.com/prime-video-not-working-on-roku/ [17]: https://www.rokucom-support.com/how-to-activate-nfl-game-pass-on-roku/ [18]: https://www.rokucom-support.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21