Suggested problems

Seek help to know how Do I Contact The Cash App By Phone

Oct. 28, 2021, 7:25 a.m. by jonsemily

Biological Motivation

Want instant help on solving the glitches? [How Do I Contact The Cash App By Phone][1]? If you have too many queries in your mind then all that you need do to is to call the experts via cash app helpline number. With this, you can overcome your woes.

[1]: https://www.cash-apphelps.net/blog/how-do-i-contact-cash-app-by-phone/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21