Suggested problems

Know about What do you need to know about the cash app dispute ?

Oct. 27, 2021, 4:39 a.m. by smith johnson

Biological Motivation

Disputes related to sending and receiving money in Cash applications are a common issue in Cash applications. Not only that, but there may be a [cash app dispute] over failure to pay using the Cash application, scams and inadvertent payments. The good news is that a simple solution to all your problems is available in the Cash App Customer Support. To do this: First, tap the Activity tab on the Cash app's Objection home screen. Therefore, I need help and support to make a money request. Touch Spawn this transaction. If you need customer support, please contact representatives. The technical team will surely help you. If you want to know more, you can visit the website.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21