Suggested problems

Want to contact chime customer service through email?

Oct. 26, 2021, 7:04 a.m. by stuardboard

Biological Motivation

Do you want to contact [chime customer service][1] through email but don’t know the email address then you have come to the right door to get the chime customer service email id. Here you can easily get the chime customer service email id within seconds and all you need to do to get an email id is just a click on this given link.

[1]: https://www.primotechy.com/chime-customer-service/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21