Suggested problems

+91-7357771057 vashikaran without money

Oct. 22, 2021, 3:44 a.m. by mk1694878

Biological Motivation

vashikaran without money +91-7357771057 Aghori Pawan Ji Situations often make couples unable to handle their love life vashikaran specialist will help you to overcome them with ease and make your life normal again A great many people have faith in crystal gazing, and our kin in India who are putting stock in the field of soothsaying and the Indian individuals utilize the brain that is completely refreshed on any idea. In the event that we talk about soothsaying, in light of the fact that our pro-Vashikaran in India,

[https://www.loveproblemsolutionnow.info/love-life-prediction-by-date-of-birth-free-in-hindi/][1]

[https://www.loveproblemsolutionnow.info/free-black-magic-specialist-contact-number/][2]

[https://www.loveproblemsolutionnow.info/life-partner-prediction-from-kundli/][3]

[https://www.loveproblemsolutionnow.info/free-love-marriage-problem-solution-helpline-number/][4]

[https://www.loveproblemsolutionnow.info/life-partner-prediction-based-on-date-of-birth/][5]

[https://www.loveproblemsolutionnow.info/sun-moon-venus-conjunction-in-position-of-birth-chart-what-will-its-effect-on-matrimonial-life/][6]

[https://www.loveproblemsolutionnow.info/free-vashikaran-specialist-helpline-number/][7]

[https://www.loveproblemsolutionnow.info/vashikaran-without-money/][8]

[https://www.loveproblemsolutionnow.info/100-guaranteed-vashikaran-specialis/][9]

[https://www.loveproblemsolutionnow.info/love-problem-solution-baba-ji-canada/][10]

[1]: https://www.loveproblemsolutionnow.info/love-life-prediction-by-date-of-birth-free-in-hindi/ [2]: https://www.loveproblemsolutionnow.info/free-black-magic-specialist-contact-number/ [3]: https://www.loveproblemsolutionnow.info/life-partner-prediction-from-kundli/ [4]: https://www.loveproblemsolutionnow.info/free-love-marriage-problem-solution-helpline-number/ [5]: https://www.loveproblemsolutionnow.info/life-partner-prediction-based-on-date-of-birth/ [6]: https://www.loveproblemsolutionnow.info/sun-moon-venus-conjunction-in-position-of-birth-chart-what-will-its-effect-on-matrimonial-life/ [7]: https://www.loveproblemsolutionnow.info/free-vashikaran-specialist-helpline-number/ [8]: https://www.loveproblemsolutionnow.info/vashikaran-without-money/ [9]: https://www.loveproblemsolutionnow.info/100-guaranteed-vashikaran-specialis/ [10]: https://www.loveproblemsolutionnow.info/love-problem-solution-baba-ji-canada/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21