Suggested problems

Unitedmedicines | 100% Safe Medicines Online at Trusted Pharmacy in US

Oct. 21, 2021, 10:28 a.m. by gainth

Biological Motivation

[Unitedmedicines][1] is the best place to buy Generic Medicine Online with like ED, pain relief etc with Easy Return and 24x7 Support in USA, UK & Australia.

[1]: https://unitedmedicines.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21