Suggested problems

Do you want to know the cash app refund policy?

Oct. 19, 2021, 12:01 p.m. by alicebailey

Biological Motivation

Do you want to know the [cash app refund][1] policy? if yes, then you have chosen the right path to know the refund policy of the cash app. On this path, you can know the refund policy of the cash app the only thing you have to do for this is just a click on this link.  https://www.cashapphelps.info/blog/will-cash-app-refund-stolen-money/

[1]: https://www.cashapphelps.info/blog/will-cash-app-refund-stolen-money/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21