Suggested problems

How to fix it if a cash app transfer failed?

Oct. 19, 2021, 10:28 a.m. by miler david

Biological Motivation

Are you utilizing the money application and need to realize how to fix it on the off chance that a [cash app transfer failed][1], you have gone to the perfect spot. At this spot, you can without much of a stretch figure out how to fix a money application move disappointment you simply need to tap on the given connection, and in seconds you can figure out how to fix it.

[1]: https://www.cash-app-helps.com/blog/cash-app-transfer-failed/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21